View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12086_high_11 (Length: 365)
Name: NF12086_high_11
Description: NF12086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12086_high_11 |
 |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0019 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 87 - 347
Target Start/End: Original strand, 65490 - 65750
Alignment:
| Q |
87 |
gaagcacataccatgctttgtcagggttattctgctcatggcaaaaaggcctattttgagtgaatttgcaatctaaatgatttttaggtttctgccaaat |
186 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
65490 |
gaagcacataccatgctttgtcaggattattttgctcttggcaaaaaggcctattttgagtgaatttgcaatctaaatgattttttggtttctgccaaat |
65589 |
T |
 |
| Q |
187 |
agcaatatcacctttctccactattttattccaacaaaggcttttagctacattctcaattttggtttgctcttcattcaagtcttcttctgttctttcc |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
65590 |
tgcaatatcacctttctccactattttattccaacaaaggcttttagctacattctcaattttggtttgctcttcattcaagtcttcttttgttctttcc |
65689 |
T |
 |
| Q |
287 |
catcctttccaatatttcttccagcgaattggtggaccagatagaatccaatacccaccag |
347 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
65690 |
catcctttccaatatctcttccagtgaattggtggaccagatagaatccaatacccaccag |
65750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 272 - 345
Target Start/End: Complemental strand, 42399444 - 42399371
Alignment:
| Q |
272 |
tcttctgttctttcccatcctttccaatatttcttccagcgaattggtggaccagatagaatccaatacccacc |
345 |
Q |
| |
|
||||| ||||||||||| || |||| ||||||||||| | ||| ||||| ||||| ||||||||||| ||||| |
|
|
| T |
42399444 |
tcttcagttctttcccagcccctccagtatttcttccatctaataggtgggccagaaagaatccaataaccacc |
42399371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University