View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12086_low_16 (Length: 225)

Name: NF12086_low_16
Description: NF12086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12086_low_16
NF12086_low_16
[»] chr3 (1 HSPs)
chr3 (20-215)||(44057016-44057211)


Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 20 - 215
Target Start/End: Original strand, 44057016 - 44057211
Alignment:
20 cagttcatggacagatattgcagatggatgataaggagggaaaataatgtaagaagaaaaggaaggactatttttcgtttttgctttgtttgacgaaaat 119  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44057016 cagttcttggacagatattgcagatggatgataaggagggaaaataatgtaagaagaaaaggaaggactatttttcgtttttgctttgtttgacgaaaat 44057115  T
120 tagaaactagaggaaggtagagagaaaagaaggttggttttgttttggtggttttccactccaagtgggaattcaagttaaattctacggcctatg 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
44057116 tagaaactagaggaaggtagagagaaaagaaggttggttttgttttggtggttttccactccaattgggaattcaagttaaattctacggcctatg 44057211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University