View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12086_low_16 (Length: 225)
Name: NF12086_low_16
Description: NF12086
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12086_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 20 - 215
Target Start/End: Original strand, 44057016 - 44057211
Alignment:
| Q |
20 |
cagttcatggacagatattgcagatggatgataaggagggaaaataatgtaagaagaaaaggaaggactatttttcgtttttgctttgtttgacgaaaat |
119 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44057016 |
cagttcttggacagatattgcagatggatgataaggagggaaaataatgtaagaagaaaaggaaggactatttttcgtttttgctttgtttgacgaaaat |
44057115 |
T |
 |
| Q |
120 |
tagaaactagaggaaggtagagagaaaagaaggttggttttgttttggtggttttccactccaagtgggaattcaagttaaattctacggcctatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44057116 |
tagaaactagaggaaggtagagagaaaagaaggttggttttgttttggtggttttccactccaattgggaattcaagttaaattctacggcctatg |
44057211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University