View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12089_high_2 (Length: 239)
Name: NF12089_high_2
Description: NF12089
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12089_high_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 31 - 230
Target Start/End: Complemental strand, 10254336 - 10254137
Alignment:
| Q |
31 |
ttcttctccaacttattctaactttttatagctttctctagattcatctcaccccaatcaatcaaaaatagaatatattcttgaagcaatagccattctc |
130 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10254336 |
ttcttctccaacttgttctaactttttatagctttctctagattcatctcaccccaatcaatcaaaaatagaatatattcttgaagcaatagccattctc |
10254237 |
T |
|
| Q |
131 |
tttcttcacttagggaatataatctttcaatcaattctaatctttgataaatttcactttttatcatatatattcccactccattttcctagcttcttct |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10254236 |
tttcttcacttagggaatataatctttcaatcaattctaatctttgataaatttcactttttatcatatatattcccactccattttcctagcttcttct |
10254137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University