View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12090_low_9 (Length: 303)
Name: NF12090_low_9
Description: NF12090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12090_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 62 - 288
Target Start/End: Original strand, 41686376 - 41686601
Alignment:
| Q |
62 |
ggtattttctgttttcaaaattgtatacaagggaaactgattctattcctgcaatgtacagatttaatgatattttttgtaatatgtgaactatattttg |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
41686376 |
ggtattttctgttttcaaaattgtatacaagggaaactgattctattcctgcaatgtacagatttaatgatatttt-tgtaatatgtgaactgtattttg |
41686474 |
T |
|
| Q |
162 |
tttcgacattttagcgacatttgctgcttatgtttctgatgataagtaagttcaactgttttttctattgtttctgaaataaatacgaagaagtggtgat |
261 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41686475 |
tttcgacattttagcgacattttctgcttatgtttctgatgataagtaagttcaactgttttttctattgtttctgaaataaatacgaagaagtggtgat |
41686574 |
T |
|
| Q |
262 |
atatgaagcaatattcttgtctgtgct |
288 |
Q |
| |
|
||||||||||||||||||||| ||||| |
|
|
| T |
41686575 |
atatgaagcaatattcttgtcggtgct |
41686601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University