View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12091_high_13 (Length: 228)
Name: NF12091_high_13
Description: NF12091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12091_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 8035931 - 8036153
Alignment:
| Q |
1 |
tcttctgatccatctcttaccatacctttaatagataaagccaagttggtcaacgctgatacacaacaagatgagcttcataagcttcatcttgcttgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8035931 |
tcttctgatccatctcttaccatacctttaatagataaagccaagttggtcaacgctgatacacaacaagatgagcttcataagcttcatcttgcttgta |
8036030 |
T |
|
| Q |
101 |
aaaactggggtgtttttcaggtactacaaattaagaaattactaattatttatagtag-taaaattccattcagcaatttttgccaatagtttttataaa |
199 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8036031 |
aaaattggggtgtttttcaggtactacaaattaagaaattactaattatttatagtagcaaaaattccattcagcaatttttgccattagtttttataaa |
8036130 |
T |
|
| Q |
200 |
gaaatcttggttagtctttaatt |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
8036131 |
gaaatcttggttagtctttaatt |
8036153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University