View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12091_high_8 (Length: 382)
Name: NF12091_high_8
Description: NF12091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12091_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 5e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 5e-84
Query Start/End: Original strand, 147 - 379
Target Start/End: Original strand, 34036016 - 34036239
Alignment:
| Q |
147 |
tgatttcatctgctaaatagactgtgcatcatttgtgatttgttcatatgctaccattannnnnnnnnnnnncctaacggttagtcggttagtgataatt |
246 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34036016 |
tgatttcatctgctaaatagactgtg---------tgatttgttcatatgctaccattatttttgcttttttcctaacggttagtcggttagtgataatt |
34036106 |
T |
 |
| Q |
247 |
ggaagaaaatgcaattgtgtgtgaaattttctttccttacctggaaagtgtggcacagtactagtctcatatgctcgaatagaaagtccccacagacaac |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34036107 |
ggaagaaaatgcaattgtgtgtgaaattttctttccttacctggaaagtgtggcacagtactagtctcatatgctcgaatagaaagtccccacagacaac |
34036206 |
T |
 |
| Q |
347 |
atcataaggggggctatgcttttcttctctctc |
379 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
34036207 |
atcataaggggggctatgcttttcttttctctc |
34036239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 89; Significance: 8e-43; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 262 - 369
Target Start/End: Original strand, 3217951 - 3218061
Alignment:
| Q |
262 |
tgtgtgtgaaattttctttccttacctggaaagtgtggcacagtactagtctcatatgctcgaatagaaagtccccacagacaac---atcataaggggg |
358 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3217951 |
tgtgtgtgaaactttctttccttacctggaaagtgtggcacagtactagtctcatatgctccaatagaaagtccccacagacaacaatatcataaggggg |
3218050 |
T |
 |
| Q |
359 |
gctatgctttt |
369 |
Q |
| |
|
||||||||||| |
|
|
| T |
3218051 |
gctatgctttt |
3218061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 7 - 80
Target Start/End: Original strand, 3217778 - 3217851
Alignment:
| Q |
7 |
gaaacatacaagttgcagcgataaggatggtgtttgttgaacttctccattgagagaataatatttaaaatgag |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3217778 |
gaaacatacaagttgcagcgataaggatggtgtttgttgaacttctccattgagagaataatatttaaaatgag |
3217851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University