View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12091_low_1 (Length: 761)
Name: NF12091_low_1
Description: NF12091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12091_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 62; Significance: 2e-26; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 107 - 187
Target Start/End: Complemental strand, 42438833 - 42438752
Alignment:
| Q |
107 |
ggaggttttggctctaacggcggcattgacggcgtcttcgagcttacgggaaagcatgta-taatcaaggtattcttgaacg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |||||| |||||||||||| |
|
|
| T |
42438833 |
ggaggttttggctctaacggcggcattgacggcgtcttcgagtttacgggaaagcatgtatttatcaagatattcttgaacg |
42438752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.00000000002; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 655 - 702
Target Start/End: Complemental strand, 31695237 - 31695189
Alignment:
| Q |
655 |
attatccttgtacaagtttatagagaaa-tttagaggttctatgcatta |
702 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31695237 |
attatccttgtgcaagtttatagagaaattttagaggttctatgcatta |
31695189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 654 - 701
Target Start/End: Original strand, 31877690 - 31877738
Alignment:
| Q |
654 |
gattatccttgtacaagtttatagagaaa-tttagaggttctatgcatt |
701 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
31877690 |
gattatccttgtacaagtttatagagaaattttagaggttgtatgcatt |
31877738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 655 - 702
Target Start/End: Original strand, 31938997 - 31939045
Alignment:
| Q |
655 |
attatccttgtacaagtttatagagaaa-tttagaggttctatgcatta |
702 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31938997 |
attatccttgtgcaagtttatagagaaattttagaggttctatgcatta |
31939045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University