View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12091_low_10 (Length: 259)
Name: NF12091_low_10
Description: NF12091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12091_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 16 - 249
Target Start/End: Complemental strand, 44089137 - 44088904
Alignment:
| Q |
16 |
cttttatcattgctgttgcttctgctagtgctactactactagtattttgtctatcttcactgaaaaatcttttgattctccattctttatctttttgtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44089137 |
cttttatcattgctgttgcttctgctagtgctactactactagtattttgtctatcttcactgaaaaatcttttgattctccattctttatctttttgtt |
44089038 |
T |
 |
| Q |
116 |
ctacctcagagccattttgtactttagtagtcttcttcatccaatcaaaagaaattggaaagaacgtcttcaataggaaggtttcactgtccatgctttc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44089037 |
ctacctcagagccattttgtactttagtagtcttcttcatccaatcaaaagaaattggaaagaacatcttcaataggaaggtttcactgtccatgctttc |
44088938 |
T |
 |
| Q |
216 |
aactcttaacattttaccatgtctattgcctttg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
44088937 |
aactcttaacattttaccatgtctattgcttttg |
44088904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University