View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12091_low_15 (Length: 209)
Name: NF12091_low_15
Description: NF12091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12091_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 32670443 - 32670246
Alignment:
| Q |
1 |
ccacaaaggaatatcactttcttcatatagatcatcaccaagcaaatgtgatgatgaatcaatatcaaagaaagaagcacttaacaacatctgatcaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32670443 |
ccacaaaggaatatcactttcttcatatagatcatcaccaagcaaatgtgatgatgaatcaatatcaaagaaagaagcacttaacaacatctgatcaaca |
32670344 |
T |
|
| Q |
101 |
tatttaggtgattgtaaaccttctaatccataccaattagtttccgatatcatagccatcgattcatcattaacttgatcgaaagatgacataagtga |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32670343 |
tatttaggtgattgtaaaccttctaatccataccaattagtttccgatatcatagccatcgattcatcattaacttgatcgaaagatgacataagtga |
32670246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University