View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12093_high_16 (Length: 276)
Name: NF12093_high_16
Description: NF12093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12093_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 30667976 - 30668244
Alignment:
| Q |
1 |
attttactgctacccaaagatgatgggaagccagctcaagagttgtcacagttgaacaatgctctcttggcctggcatcggcaaattttgggggatccaa |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||| ||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
30667976 |
attttactgctacccaaagacgatgggaagccagcttaagagttgtcatggttgaacaatgctctcttggcttggcatcggctaattttgggggatccaa |
30668075 |
T |
 |
| Q |
101 |
actaactgatttcaaatgatcaaataacgtgttaatgtgttattgtcatcgttacaaaaggcctaagaatgctgcaagttaattaggaaaatagcattgc |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30668076 |
actaactgatttcaaatgatcaaatgacgtgttaatgtgttattgtcatcgttacaaaaggcctaagaatgctgcaagttaattaggaaaatagcattgc |
30668175 |
T |
 |
| Q |
201 |
atggttagatatatttggctggttattgtaaaattcgtctctttctgagtttctgtttggttctgtgctgc |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
30668176 |
atggttagatatatttggctggttattgtaaaattcg--tctttctgagtttctgtttggttttgtgctgc |
30668244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University