View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12093_high_27 (Length: 232)
Name: NF12093_high_27
Description: NF12093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12093_high_27 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 13 - 215
Target Start/End: Complemental strand, 6543944 - 6543742
Alignment:
| Q |
13 |
caaaggagggaattgtgttaggacaaaaccatttagcaaggaagaaatgaacttaaatggtttcattctagagacatatttaacacaagtgaatgaattt |
112 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6543944 |
caaaggagggaattgtgtgaggaaaaaaccatttagcaaggaagaaatgaacctaaatggttacattctagagacatatttaacacaagtgaatgaattt |
6543845 |
T |
|
| Q |
113 |
aaagtagcacaagaggaagcatcaaagaaaggtttgaaatttttgatgcttaatacaactgaaattatgttgttgagacctgatggacacccaaataact |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6543844 |
aaagtagcacaagaggaagcatcaaagaaaggtttgaaatttttgatgctaaatacaactgaaattatgttgttgagacctgatggacaccctaataact |
6543745 |
T |
|
| Q |
213 |
atg |
215 |
Q |
| |
|
||| |
|
|
| T |
6543744 |
atg |
6543742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University