View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12093_low_17 (Length: 274)
Name: NF12093_low_17
Description: NF12093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12093_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 100 - 245
Target Start/End: Complemental strand, 25983142 - 25982997
Alignment:
| Q |
100 |
gttcttcttcttcaggcctttcagtgaagatgaactgcggagtaatgcaccacaagttgttacttgctatgattacaatagagaagtatcagtttctcag |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25983142 |
gttcttcttcttcaggcctttcagtgaagacgaactgcggagtaatgcaccacaagttgttacttgctatgattacaatagagaagtatcagtttctcag |
25983043 |
T |
|
| Q |
200 |
aatgttgccggcaagcattttgatagagttttcacttttgataagg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25983042 |
aatgttgccggcaagcattttgatagagttttcacctttgataagg |
25982997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University