View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12093_low_22 (Length: 246)
Name: NF12093_low_22
Description: NF12093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12093_low_22 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 32556962 - 32557207
Alignment:
| Q |
1 |
atacaacaaaggctagctaacaatctgtcttggctttcacctgagtaagcaaatttgtcacactcagagaatcccaaataatttgccacannnnnnnnaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32556962 |
atacaacaaaggctagctaacaatctgtattggctttcacccgagtaagcaaatttgtcacactcagagaatcccaaataatttgccacattttttttaa |
32557061 |
T |
|
| Q |
101 |
acataagggtggatttaaataacttcattcttttatacatcggggctgcaataagctacagttagactatactgcaggagtcattacatctatctattat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32557062 |
acataagggtggatttaaataacttcattcttttatacattggggctgcaataagctacagttagactatactgcaggagtcattacatctatctattat |
32557161 |
T |
|
| Q |
201 |
atcaaaataaactacaatttcagctaatgtatgtttcttcagttgc |
246 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
32557162 |
atcaaaataaactacaatttccgctaatgtatgtttcttcatttgc |
32557207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University