View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12093_low_28 (Length: 221)
Name: NF12093_low_28
Description: NF12093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12093_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 16 - 205
Target Start/End: Complemental strand, 9968986 - 9968798
Alignment:
| Q |
16 |
gagaaatggcggggagatgggggacatggatgcaaggacattactatgtcaggtacgtatgttttgggttatgtttctaacaatagtaaatggtgtcgtc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9968986 |
gagaaatggcggggagatgggggacatggatgcaaggacattactatgtcaggtacgtatgttttgggttatgtttctaacaatagtaaatggtgtcgtc |
9968887 |
T |
 |
| Q |
116 |
aacgtcaagcatgctaacgnnnnnnnnnnnnnnnnnntagacatttttgtcttcgaaatctaagagaagcatgctaacaaaattacaaaa |
205 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9968886 |
aacgtcaagcatgctaacaaaaaaacaaaagaaaaaatagacatttttgtctt-gaaatctaagagaagcatgctaacaaaattacaaaa |
9968798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University