View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12094_high_15 (Length: 247)
Name: NF12094_high_15
Description: NF12094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12094_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 66 - 228
Target Start/End: Original strand, 27508540 - 27508702
Alignment:
| Q |
66 |
atcaaggaagagattcagaacaaaattcactcaggaacagaaagagaaattgctggcttttgctgaagaacatggttggagaattcagaaacaagatgaa |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27508540 |
atcaaggaagagattcagaacaaaattcactcaggaacagaaagagaaattgctggcttttgcagaagaacatggttggagaattcagaaacaagatgaa |
27508639 |
T |
 |
| Q |
166 |
gctgctatagaacagttttgtgctgagaattgtatcaagagaaatgttcttaaagtttggatg |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27508640 |
gctgctatagaacagttttgtgctgagaattgtatcaagagaaatgttcttaaagtttggatg |
27508702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 82 - 228
Target Start/End: Complemental strand, 46300830 - 46300684
Alignment:
| Q |
82 |
agaacaaaattcactcaggaacagaaagagaaattgctggcttttgctgaagaacatggttggagaattcagaaacaagatgaagctgctatagaacagt |
181 |
Q |
| |
|
|||||||||||||| |||||||| || || || |||| || ||||| || || ||| |||||||||||||| ||||||||| ||| || ||||| | |
|
|
| T |
46300830 |
agaacaaaattcacgcaggaacaaaaggataagatgcttgcatttgcggagaaaattgggtggagaattcagaaggaagatgaaggtgcaattgaacaat |
46300731 |
T |
 |
| Q |
182 |
tttgtgctgagaattgtatcaagagaaatgttcttaaagtttggatg |
228 |
Q |
| |
|
| ||||||||||||| |||||||||| |||| ||||| ||||||||| |
|
|
| T |
46300730 |
tctgtgctgagaattttatcaagagacatgtgcttaaggtttggatg |
46300684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University