View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12095_high_21 (Length: 241)
Name: NF12095_high_21
Description: NF12095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12095_high_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 42003803 - 42004033
Alignment:
| Q |
1 |
atgacgcatcccccgattttcgttatgggcctcgacggggcaacaatcgaaagataccctaaaacccagcttggtgaaagtggacgattgcctaggccaa |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42003803 |
atgacgcaccccccgattttcgttatgggcctcgacggggcaacaatcgaaagataccctaaaacccagcttggtgaaagtggacgattgcctaggccta |
42003902 |
T |
|
| Q |
101 |
gtgacaacacttgctctatatgtctttgtgattatcagccaaatgaagtattgaggacaattcccgagtgtaatcactattttcatgtgaattgtataga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42003903 |
gtgacaacacttgctctatatgtctttgtgagtatcagccaaatgaagtattgaggacaattcctgagtgtaatcactattttcatgtgaattgtataga |
42004002 |
T |
|
| Q |
201 |
tggatggctcaagacaaatgctacctgccct |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42004003 |
tggatggctcaagacaaatgctacctgccct |
42004033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University