View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12095_high_23 (Length: 240)

Name: NF12095_high_23
Description: NF12095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12095_high_23
NF12095_high_23
[»] chr8 (1 HSPs)
chr8 (158-223)||(42003511-42003576)


Alignment Details
Target: chr8 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 158 - 223
Target Start/End: Complemental strand, 42003576 - 42003511
Alignment:
158 catcattgactatttctgaccttgggtgggaagatcataacaagcaagacgaagagcatcatcccc 223  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
42003576 catcattgactatttctcaccttgggtgggaagatcataacaagcaagacgaagagcatcatcccc 42003511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University