View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12095_high_6 (Length: 478)
Name: NF12095_high_6
Description: NF12095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12095_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 96 - 462
Target Start/End: Complemental strand, 35764067 - 35763673
Alignment:
| Q |
96 |
tgagggtagaatcgggttttgttgagaagcggttttgttgttgttgttgatgaaattggaaattggagatgagtaagaacaacgcgcgtgaaagaacgga |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35764067 |
tgagggtagaatcgggttttgttgagaagcggttttgttgttgttgttgatgaaattggaaattggagatgaataagaacaacgcgcgtgaaagaacgga |
35763968 |
T |
|
| Q |
196 |
gacgttgccatgaagtgtatgtatatgtatttatatagctatagatagataga----------------------gatggttgtaaatctatcctgaatt |
273 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
35763967 |
gacgttgccatgaagtgtatgtatatgtgtttatatagctatagatagatagatagagatagagatagagatagagatggttgtaaatatatcctgaatt |
35763868 |
T |
|
| Q |
274 |
ctctctctct----tttcaaagcaaagtgtctgttgcttatgcttaatgaccaaatcacgatacaatcatggaatggaactcagaagta-----ccattc |
364 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
35763867 |
ctctctctctctcttttcaaagcaaagtgtctgttgcttatgcttaatgaccaaatcacgatacaatcatggaatggaactcagaagtaccaatccaatc |
35763768 |
T |
|
| Q |
365 |
caaagatgataataaaacaaaaattatttgtattgtcttcccataaagttcattcatttatcccaagaagacaattgcgataatatgatccatgattt |
462 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
35763767 |
caaagatgataataaaacaaaaattatttgtattgtcttcccataaagttcattcatttatcccaagaaaacaattgcg---atatgatccatgattt |
35763673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University