View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12095_low_16 (Length: 362)
Name: NF12095_low_16
Description: NF12095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12095_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 2 - 225
Target Start/End: Complemental strand, 28423286 - 28423063
Alignment:
| Q |
2 |
gtcccacaatagtcaacggaacgggaatagtcaatgtttcgctgaaattattggttccaccgttgtagatgaatgttccaacgtcggagtcgtcggcggt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28423286 |
gtcccacaatagtcaacggaacgggaatagtcaacgtttcgctgaaattattggttccaccgttgtagatgaatgttccaacgtcggagtcgtctgcggt |
28423187 |
T |
|
| Q |
102 |
gcagctcgtgtatgcggttttgttgtacgtgagaatcacgctctgatttgaattcgtgttgaaaactacaaaaataaaaagattaatcaccggacacaga |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28423186 |
gcagctcgtgtatgcggttttgttgtacgtgagaatcacgctctgatttgaattcgtgttgaaaactacaaaaataaaaagattaatcaccggacacaga |
28423087 |
T |
|
| Q |
202 |
tgacaggattcaatataattatgt |
225 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
28423086 |
tgacatgattcaatataattatgt |
28423063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 242 - 344
Target Start/End: Complemental strand, 28423007 - 28422905
Alignment:
| Q |
242 |
taatgaatttaaagatctagagagagggattgagcttactgagataatcgccgaggttgaaagattgagaggaagcccaagaagagtaattggtggcgga |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28423007 |
taatgaatttaaagatctagagagagggattgagcttactgagataatcgccgaggttgaaagattgagaggaagcccaagaagagtaattggtggcgga |
28422908 |
T |
|
| Q |
342 |
agt |
344 |
Q |
| |
|
||| |
|
|
| T |
28422907 |
agt |
28422905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University