View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12095_low_21 (Length: 256)
Name: NF12095_low_21
Description: NF12095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12095_low_21 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 256
Target Start/End: Original strand, 1722341 - 1722601
Alignment:
| Q |
1 |
gtagcgttattgttgaaagaaagaagaaacaagaacnnnnnnnn------cctttgaatggagacccgtcacttttggaggcccagttaaactcgggtga |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || || |||||||||| |
|
|
| T |
1722341 |
gtagcgttattgttgaaagaaagaagaaacaagaacttttttttttttttcctttgaatggagacccgtcacttttggaggcc-agctagactcgggtga |
1722439 |
T |
 |
| Q |
95 |
gctttttgcactcaaggatgaccttgttggttacactatatagtatgtctaaaagtcaggcttcactttaatttcccaacttttgtttagaggaatataa |
194 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1722440 |
gctttctgcactcaaggacaaccttgttggttacactatatactatgtctaaaagtcaggcttcactttaatttcccaacttttgtttagaggaatataa |
1722539 |
T |
 |
| Q |
195 |
tctaccaacttaaaatctaaannnnnnnatgatctttcatctaaaaatgttgtgctcctaat |
256 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1722540 |
tctaccaacttaaaatctaaacttttttatgatctttcatctaaaaatgttgtgctcctaat |
1722601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University