View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12095_low_9 (Length: 467)
Name: NF12095_low_9
Description: NF12095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12095_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 226
Target Start/End: Original strand, 14103907 - 14104115
Alignment:
| Q |
18 |
acgttcatggatcgttcttttcatcacaggaattctccttttacctcttttcatctttgcaacaccaatcttaaacttttttggacaaccacaagagata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14103907 |
acgttcatggatcgttcttttcatcacaggaattctccttttacctcttttcatctttgcaacaccaatcttaaacttttttggacaaccacaagagata |
14104006 |
T |
|
| Q |
118 |
tctgagctagctggagtgatttcaatgtggctaataccaactcacgtgacttatgcattcttttttcctctttatttcttcttgcaaagtcagctcaaga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14104007 |
tctgagctagctggagtgatttcaatgtggctaataccaactcacgtgacttatgcattcttttttcctctttatttcttcttgcaaagtcagctcaaga |
14104106 |
T |
|
| Q |
218 |
ataacatca |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
14104107 |
ataacatca |
14104115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 143; E-Value: 6e-75
Query Start/End: Original strand, 289 - 456
Target Start/End: Original strand, 14104178 - 14104345
Alignment:
| Q |
289 |
aagtttaagcttggtgttattgctcttgttgcttctgggaatgtggcttggattgttttggtgtttggnnnnnnngggtatgctgttttgggtggttgtc |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
14104178 |
aagtttaagcttggtgttattgctcttgttgcttctgggaatgtggcttggattgttttggtgtttggtttttttgggtatgctgttttgtgtggttgtc |
14104277 |
T |
|
| Q |
389 |
ccttaacttggactggtttttctatggaggctttctttgatctttgggagtttgctaaactctctgct |
456 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14104278 |
ccttaacttggactggtttttctatggaggctttctttgatctttgggagtttgctaaactctctgct |
14104345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 379 - 456
Target Start/End: Original strand, 14092607 - 14092684
Alignment:
| Q |
379 |
ggtggttgtcccttaacttggactggtttttctatggaggctttctttgatctttgggagtttgctaaactctctgct |
456 |
Q |
| |
|
||||||||||| || ||||||| ||| ||||||||||||||||| | || |||||||| |||| |||||| |||||| |
|
|
| T |
14092607 |
ggtggttgtcctttgacttggaatgggttttctatggaggctttttctgggctttgggaatttgttaaactttctgct |
14092684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University