View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12096_low_5 (Length: 436)
Name: NF12096_low_5
Description: NF12096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12096_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 306; Significance: 1e-172; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 18 - 398
Target Start/End: Complemental strand, 8446551 - 8446166
Alignment:
| Q |
18 |
gttagatcagcagattaataacgaccagtactatgctttctatgcattttataatatttttcactttctatcgtgattgttgacatggctccttttcttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8446551 |
gttagatcagcagattaataacgaccagtactatgctttctatgcattttataatatttttcaatttctatcgtgattgttgacatggctccttttcttt |
8446452 |
T |
|
| Q |
118 |
atttgtatgatgaacattttgattcgagtgatctaggatgctaaattgttaagctttgattctaaattttgattatcttgaaaaatgtcacttggcctct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8446451 |
atttgtatgatgaacattttgattcgagtgatttaggatgctaaattgttaagctttgattctaaattttgattatcttgaaaaatgtca-----cctcc |
8446357 |
T |
|
| Q |
218 |
agtgatctaggaagctaaattatggcacactagctattcctttggcataaaaactaatataatataatctaaagtggatttctaggggtacgaacataag |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8446356 |
agtgatctaggaagctaaattatggcacactagctattcctttggcataaaaactaatataatctaatctaaagtggatttctaggggtacgaacataag |
8446257 |
T |
|
| Q |
318 |
agactaaagtatctaatttttgtaaattacaggg-----------tatgctctattgttctaatctttgtccctaactctttccctttgtaa |
398 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8446256 |
agactaaagtatctaatttttgtaaattacagggatcttcacctctattctctattgttctaatc-ttgtccctaactctttccctttgtaa |
8446166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 356 - 425
Target Start/End: Complemental strand, 8446141 - 8446072
Alignment:
| Q |
356 |
ctctattgttctaatctttgtccctaactctttccctttgtaatccctcaactgttttcttccccgtctc |
425 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8446141 |
ctctattgttctaatctttgtccctaactctttccctttgtaatccctcaactgttttcttccccgtctc |
8446072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University