View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12097_high_18 (Length: 230)
Name: NF12097_high_18
Description: NF12097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12097_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 170
Target Start/End: Original strand, 27956416 - 27956597
Alignment:
| Q |
1 |
catgttcataacttacggctgattcatagttataaacttgaaattgtatatgatacgatataaatatgatggttcaatacattgtttgtcattattttct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27956416 |
catgttcataacttacggctgattcatagttataaacttgaaattgtatatgatacgatataaatatgatgcttcaatacattgtttgtcattattttct |
27956515 |
T |
 |
| Q |
101 |
tata------------tcaataatactattaagtgtgaaagatttcttcaaattcatgaaaagtgttttagagtagtcacga |
170 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27956516 |
tataacaattcttatgtcaataatactattaagtgtgaaagatttcttcaaattcatgaaaagtgttttagagtagtcacga |
27956597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University