View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12097_low_19 (Length: 228)
Name: NF12097_low_19
Description: NF12097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12097_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 20 - 213
Target Start/End: Complemental strand, 43003892 - 43003701
Alignment:
| Q |
20 |
gctaagacaaccaagacatgttcacccaaaatcttaacacattgaaaaattgaatcacacatctcttatatatcgaacatttaacttattatcggtaaga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43003892 |
gctaagacaaccaagacatgttcacccaaaatcttaacacattgaaaaattgaatcaca--tctcttatatatcgaacatttaacttattatcggtaaga |
43003795 |
T |
 |
| Q |
120 |
ctaattaacacttaaacccaacaagatgttgtgttttagtcccttgtttatcggcatggtcattagtctcttattttttggtgctttctctctg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43003794 |
ctaattaacacttaaacccaacaagatgttgtgttttagtcccttgtttatcgtcatggtcattagtctcttattttttggtgctttctctctg |
43003701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University