View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12098_high_3 (Length: 325)
Name: NF12098_high_3
Description: NF12098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12098_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 96 - 307
Target Start/End: Original strand, 43301648 - 43301861
Alignment:
| Q |
96 |
aagacgccgttgcattatttttagtgctaagcttgtaaatatatttatttcaagtgctgttgtattagtgt--gattgtatatattggttagatcggata |
193 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43301648 |
aagatgccgttgcattatttttagtgctaagcttgtaaatatatttatttcaagtgctgttgtattagtgtgtgattgtatatattggttagatcggata |
43301747 |
T |
 |
| Q |
194 |
gttgttttagggattgcatttggaagtgcatttctgctcagaagttgcatttgtaagcacaggctgcatagcacattctgctcatggcatatgttttact |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43301748 |
gttgttttagggattgcatttggaagtgcaattctgctcagaagttgcatttgtaagcacaggctgcatagcacattctgctcatggcatatgttttact |
43301847 |
T |
 |
| Q |
294 |
tgtcaccatatatt |
307 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
43301848 |
tgtcaccatatatt |
43301861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University