View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12098_low_4 (Length: 346)
Name: NF12098_low_4
Description: NF12098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12098_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 18 - 332
Target Start/End: Original strand, 2872081 - 2872395
Alignment:
| Q |
18 |
agtattgatgcattgctcttaaaaccgagacaaaatcagaatcaaatcgttcaaacgatatatagtgtcggttcacaattacacaaattgaactgtgttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
2872081 |
agtattgatgcattgctcttaaaaccgagacaaaatcacaatcaaatcgttcaaacgatatatagtgtcggttcacaattacacgaattgaaccgtgttg |
2872180 |
T |
|
| Q |
118 |
ctcgnnnnnnnn-aaacattgatcataattttctcactttcaacatttcttttcttcctatcttttgctcccttacatgaggacatcattttcaattact |
216 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2872181 |
ctcgtttttttttaaacattgatcataattttctcactttcaacatttcttttcttcctatcttttgctcccttacatgaggacatcattttcaattact |
2872280 |
T |
|
| Q |
217 |
caataatctcatatcacttttatggnnnnnnnnnnnngtcatgtgtttgttaatacatatatttttcttttagagttgggattgagattccaacaattga |
316 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2872281 |
caataatctcatatcacttttatgg-gttttttatttgtcatgtgtttgttaatacatatatttttcttttagagttgggattgagattccaacaattga |
2872379 |
T |
|
| Q |
317 |
agttcgttttgagcac |
332 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
2872380 |
agttcgttttgagcac |
2872395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 281 - 320
Target Start/End: Original strand, 2882561 - 2882600
Alignment:
| Q |
281 |
ttcttttagagttgggattgagattccaacaattgaagtt |
320 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2882561 |
ttcttttagagttgggattgagattccagcaattgaagtt |
2882600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 281 - 320
Target Start/End: Complemental strand, 2902452 - 2902413
Alignment:
| Q |
281 |
ttcttttagagttgggattgagattccaacaattgaagtt |
320 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
2902452 |
ttcttttagagttggtattgagattccaacaatagaagtt |
2902413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University