View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12098_low_6 (Length: 304)
Name: NF12098_low_6
Description: NF12098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12098_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 15 - 251
Target Start/End: Complemental strand, 13283695 - 13283459
Alignment:
| Q |
15 |
tgatctgaaaccagtggtgaaaatgatttgttgatgatttagtgaaggtgtaatataagttgatcgatctcaaatcattgctgagattgactgctgcgtg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13283695 |
tgatctgaaaccagtggtgaaaatgatttgttgatgatttagtgaaggtgtaatgtaagttgatcgatctcaaatcattgctgagattgactgatgcgtg |
13283596 |
T |
|
| Q |
115 |
tgttgcattgagagccgaaccgaagaaacgcagcatcactatacacataacaaaaacagaacagcaaccatcaacatatattgtaaaatactaattaagt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13283595 |
tgttgcattgagagccgaaccgaagaaacgcagcatcactatacacataacaaaaacagaacagcaaccatcaacatatattgtaaaatactaattaagt |
13283496 |
T |
|
| Q |
215 |
tataacatatgattgcaaatttttatataattaaaca |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13283495 |
tataacatatgattgcaaatttttatataattaaaca |
13283459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University