View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12099_low_5 (Length: 387)
Name: NF12099_low_5
Description: NF12099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12099_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 1e-50; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 23 - 124
Target Start/End: Complemental strand, 8159463 - 8159362
Alignment:
| Q |
23 |
tatgatcccaggggaagagacccttcctacggccatgaccttggccctcaaattcctcactgattatcctcttgctctatccaaacttatggtaagttca |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8159463 |
tatgatcccaggggaagagacccttcctacggccatgaccttggccctcaaattcctcactgattatcctcttgctctatccaaacttatggtaagttca |
8159364 |
T |
|
| Q |
123 |
ct |
124 |
Q |
| |
|
|| |
|
|
| T |
8159363 |
ct |
8159362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 311 - 373
Target Start/End: Complemental strand, 8159363 - 8159301
Alignment:
| Q |
311 |
ctaaatataaaagatttatgtttgtgtccaaccaaatgtagctccaaagatgaatatatattg |
373 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8159363 |
ctaaatataaaagatttatgtctgtgtccaaccaaatgtagctccaaagatggatatatattg |
8159301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 173 - 244
Target Start/End: Complemental strand, 36407300 - 36407229
Alignment:
| Q |
173 |
acttacttagtcacaaacacaaatattttacatttagacacgcatacattaacaatcacatcattcatttat |
244 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||| | |||| |||||||||||||||| |||||||||| |
|
|
| T |
36407300 |
acttacttgatcactaacacaaatattttacatttaagcgcgcacacattaacaatcacataattcatttat |
36407229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 298 - 354
Target Start/End: Original strand, 27900012 - 27900068
Alignment:
| Q |
298 |
aatgggcgtgtgcctaaatataaaagatttatgtttgtgtccaaccaaatgtagctc |
354 |
Q |
| |
|
|||| ||||||||||||||||||||| | ||||||||||||||||||| |||||||| |
|
|
| T |
27900012 |
aatgagcgtgtgcctaaatataaaagttctatgtttgtgtccaaccaagtgtagctc |
27900068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 305 - 344
Target Start/End: Complemental strand, 41827913 - 41827874
Alignment:
| Q |
305 |
gtgtgcctaaatataaaagatttatgtttgtgtccaacca |
344 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41827913 |
gtgtgcctaaatataaaagatttatggttgtgtccaacca |
41827874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University