View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12099_low_6 (Length: 375)
Name: NF12099_low_6
Description: NF12099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12099_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 1 - 358
Target Start/End: Original strand, 43034934 - 43035290
Alignment:
| Q |
1 |
catgcctcgagacgaccccatgatttccagctacagctactcacagtggagcctccaattgagcggagaataacccacgcgcctgcgtttgatcgtgaca |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43034934 |
catgcctcgagatgaccccatgatttccagctacagctactcacagtggagcctccgatcgcgcggagaataacccacgcgcctgcgtttgatcgtgaca |
43035033 |
T |
|
| Q |
101 |
cccgatctgagccgggggatggaacaaatggtgtgatcatggatgctgcagcaacgggcgagcctgatagatcgtgaattactatcatccaaccctttct |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43035034 |
cccgatctgagctgggggatggaacaaatggtgtgatcatggatgctgcagcaacgggcgagcctgatagatcgtgaattactatcatccaaccctttct |
43035133 |
T |
|
| Q |
201 |
ctcattcccttgtccactgttctctttcacctctcaatggtcttctccatctgcttgaattattgtttgtagaatccgacgaaagaggcctgaattttca |
300 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43035134 |
ctcattcccttgtccgctgttctctttcacctctcaatggtcttctccatctgcttgaattattgtttgtagaatccgacgaaagaggcctgaattttca |
43035233 |
T |
|
| Q |
301 |
agttggttaataaaatatnnnnnnnncatttaattgattgaagtaacaagcatgatct |
358 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43035234 |
agttggttaataaaatat-aaaaaaacatttaattgattgaagtaacaagcatgatct |
43035290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 87 - 200
Target Start/End: Complemental strand, 34193884 - 34193771
Alignment:
| Q |
87 |
gtttgatcgtgacacccgatctgagccgggggatggaacaaatggtgtgatcatggatgctgcagcaacgggcgagcctgatagatcgtgaattactatc |
186 |
Q |
| |
|
|||||||| ||| || | ||||||||| ||||| || ||||||||||||| ||| || ||||||||||| || || || || |||||||||| | |||| |
|
|
| T |
34193884 |
gtttgatcttgatactctatctgagccaggggaagggacaaatggtgtgaccattgaggctgcagcaaccggggaacccgagagatcgtgaactgttatc |
34193785 |
T |
|
| Q |
187 |
atccaaccctttct |
200 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
34193784 |
atccaaccctttct |
34193771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University