View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12100_high_3 (Length: 238)
Name: NF12100_high_3
Description: NF12100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12100_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 41701071 - 41700853
Alignment:
| Q |
1 |
ataattctttcaagttccactgcttcttcacaatgggagaggcagttaattatggcttcacaaaaa-gcttattgtgttggtaatagcagcactgattac |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41701071 |
ataattctttcaagttccactgcttcttcacaatgggagaggcagttaattatggcttcacaaaaaagcttattgtgttggtaatagcagcactgattac |
41700972 |
T |
|
| Q |
100 |
gcataatgcaaatgttgcccatcttggagtacaaaacgccttctaagctgagctcttgagtgctattttgactattaattaaaattacaaatagtagtat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
41700971 |
gcataatgcaaatgttgcccatcttggagtacaaaacgccttctaagctgagctcttgagtgctattttgattattaattaaaattacaaa------tat |
41700878 |
T |
|
| Q |
200 |
attttttcataggccccatatattg |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
41700877 |
gttttttcataggccccatatattg |
41700853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University