View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12100_low_10 (Length: 224)
Name: NF12100_low_10
Description: NF12100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12100_low_10 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 9 - 224
Target Start/End: Complemental strand, 41701317 - 41701100
Alignment:
| Q |
9 |
tttgataccatgttattgacaatcggccaaaaatgattttgctaatgacttgtaaaatacttgattatttcaattcatattatggttaacgagttacttt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41701317 |
tttgataccatgttattgacaatcggccaaaaatgattttgctaatgacttgcaaa-tacttgattatttcaattcatattatggttaacgagttacttt |
41701219 |
T |
 |
| Q |
109 |
gacactatatactatatgatttaattttatggtggaaaacttgattacgtgtggaaattaaaacattttaaagnnnnnnntatcttacttt---agaaga |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |||||| |
|
|
| T |
41701218 |
gacactatatactatatgatttaattttatggtggaaaacttgattacgtgtggaaattaaaactttttaaagaaaaaaatatcttactttagaagaaga |
41701119 |
T |
 |
| Q |
206 |
gtgggataagtcaaaagct |
224 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
41701118 |
gtgggataagtcaaaagct |
41701100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University