View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12100_low_6 (Length: 264)
Name: NF12100_low_6
Description: NF12100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12100_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 38699766 - 38699542
Alignment:
| Q |
18 |
gaaagttctatgacctccttccttggacgacagataaatttgttatatatgattgttgtaaattgatgttgcaaaataaacgatggatctgaacaatgca |
117 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38699766 |
gaaagttctatgacctcctt----ggacgacagataaatttgttatatatgattgttgtaaattgatgttgcaaaataaacgatggatctgaacaatgca |
38699671 |
T |
|
| Q |
118 |
ataaaaaatcatgacaacattttcttcattcgatgttggagaaggacctttgctcttcttgtatgtaacctatccaacttaattatgctcaaaccctatt |
217 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38699670 |
ataaaaaatcatgacaatattttcttcaatcgatgttggagaaggacctttgctcttcttgtatgtaacctatccaacttaattatgctcaaaccctatt |
38699571 |
T |
|
| Q |
218 |
ccatcacatcagtttacttatgatttcat |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38699570 |
ccatcacatcagtttacttatgatttcat |
38699542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University