View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12105_low_5 (Length: 259)
Name: NF12105_low_5
Description: NF12105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12105_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 23944209 - 23943961
Alignment:
| Q |
1 |
gtgtcatggaaaatcttcccttctcttctctgatgtcagaattcacctaatgctc--agaagtagtacatgcattgttagcatgttgttaccacttgtta |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
23944209 |
gtgtcatggaaaatcttcccttctcttctctgatgtcagaattcacctattgctctcagaagtagtacatgcattgttagcaggttgttaccacttgtta |
23944110 |
T |
|
| Q |
99 |
ctaattgtcattcacatgcacagttcatgaaatctttgccttggaagatgattttagggtagacagttatatgtagcagaa--gcagaaattaaaagtat |
196 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| ||||| || | ||||||| ||||||||||||||||| |
|
|
| T |
23944109 |
ctaattgtcattcacatgcatagttcatgaaatctttgccttggaagatgattttagcgtaggcagttgtagggagcagaaacgcagaaattaaaagtat |
23944010 |
T |
|
| Q |
197 |
gtctatctccatttgcatgcgtagcagaagcatacttccaattgccaca |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23944009 |
gtctatctccatttgcatgcgtagcagaagcatacttccaattgccaca |
23943961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University