View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12106_high_10 (Length: 348)
Name: NF12106_high_10
Description: NF12106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12106_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 20 - 318
Target Start/End: Complemental strand, 52988156 - 52987858
Alignment:
| Q |
20 |
gacatcatcaccgagcacgttgaattagcctcgatgcatggttgttcaagtccggcagagaaagaaaaagattcttgtacagactgccccaaattgcctg |
119 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52988156 |
gacatcataaccgagcacgttgaattagcctcgatgcatggttgttcaaatctggcagagaaagaaaaagattcttgtaaagactgccccaaattgcctg |
52988057 |
T |
 |
| Q |
120 |
ttgtgtgtggtggctgtgagggtccaaatgagagggaagttagtccatgatgcaagaatgagggctattcaaaggaatcgatcgaatcgtcaattatgca |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52988056 |
ttgtgtgtggtggctgtgagggtccaaatgagagggaagttagtccatgttgcaagaatgagggctattcaaaggaatcgatagaatcgtcaattatgca |
52987957 |
T |
 |
| Q |
220 |
tgcttgcattagttttgacaagagagaagttggtggatgttgcaagagctacatgaaggaatgctgtggcaggcatggacattcaggggctggtagttt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52987956 |
tgcttgcattagttttgacaagagagaagttggtggatgttgcaagagctacatgaaggaatgctgtggcaggcatggacattcaggggctggtagttt |
52987858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University