View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12110_high_7 (Length: 391)

Name: NF12110_high_7
Description: NF12110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12110_high_7
NF12110_high_7
[»] chr7 (1 HSPs)
chr7 (2-44)||(8579856-8579898)


Alignment Details
Target: chr7 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 2 - 44
Target Start/End: Complemental strand, 8579898 - 8579856
Alignment:
2 gttcctcttcctctctcatcacctcgtcgtgcgccatattaac 44  Q
    |||||||||||||||||||||||||||||||||||||||||||    
8579898 gttcctcttcctctctcatcacctcgtcgtgcgccatattaac 8579856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University