View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12110_high_8 (Length: 389)
Name: NF12110_high_8
Description: NF12110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12110_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 24 - 384
Target Start/End: Complemental strand, 45541327 - 45540970
Alignment:
| Q |
24 |
tgcttcagttaccttcaaaccttcttcgtgaagttcggcagttcccttgcttatagcgttgaatttattcacaggtactggaggttgatgatttggcgaa |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45541327 |
tgcttcagttaccttcaaaccttcttcgtgaagttcggcagttcccttgctaatagcgttgaatttattcacaggtactggaggttgatgatttggcgaa |
45541228 |
T |
 |
| Q |
124 |
gcaatatgctgatcggacatatatacatcaccagacttatctaaatcagaagaagatttgaagcaagctagttcacttgagaaacttgtatttcccatat |
223 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45541227 |
gcaatatactgatcggacatacatacatcaccagacttatctaaatcagaaga---tttgaagcaagctagttcacttgagaaacttgtatttcccatat |
45541131 |
T |
 |
| Q |
224 |
aaatgctgaagagtgattcgttagaggcagtgctccattctactggggcatttgtattgtttctagcaaatacatgagatggaaagacatattgggcatt |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45541130 |
aaatgctgaagagtgattcgttagaggcagtgctccattctactggggcatttgtattgtttctagcaaatacatgagatggaaagacatattgggcatt |
45541031 |
T |
 |
| Q |
324 |
agtcacattttcacttggacgctccatcaattgtatcggcgggttttgtatctctgctcct |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45541030 |
agtcacattttcacttggacgctccatcaattgtatcggcgggttttgtatctctggtcct |
45540970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University