View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12110_low_16 (Length: 337)

Name: NF12110_low_16
Description: NF12110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12110_low_16
NF12110_low_16
[»] chr3 (2 HSPs)
chr3 (20-130)||(22191170-22191280)
chr3 (135-179)||(6983341-6983385)


Alignment Details
Target: chr3 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 20 - 130
Target Start/End: Original strand, 22191170 - 22191280
Alignment:
20 actggttcaaggcattttgcttttgcttcacccagtttgtggtgtgtaatgcatacaatatgttttgttatgagagtttgtatctcttttatggattgta 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
22191170 actggttcaaggcattttgcttttgcttcacccagtttgtggtgtgtaatgcatacaatatgttttgttatgagagtttgtatctctttgatggattgta 22191269  T
120 agacattattt 130  Q
    |||| ||||||    
22191270 agactttattt 22191280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 135 - 179
Target Start/End: Original strand, 6983341 - 6983385
Alignment:
135 atttattttcaaatgcatctctgatattaccaatttaatgtcatc 179  Q
    |||||||||||||| ||||||  |||||||||| |||||||||||    
6983341 atttattttcaaattcatctcctatattaccaacttaatgtcatc 6983385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University