View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12110_low_16 (Length: 337)
Name: NF12110_low_16
Description: NF12110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12110_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 20 - 130
Target Start/End: Original strand, 22191170 - 22191280
Alignment:
| Q |
20 |
actggttcaaggcattttgcttttgcttcacccagtttgtggtgtgtaatgcatacaatatgttttgttatgagagtttgtatctcttttatggattgta |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
22191170 |
actggttcaaggcattttgcttttgcttcacccagtttgtggtgtgtaatgcatacaatatgttttgttatgagagtttgtatctctttgatggattgta |
22191269 |
T |
|
| Q |
120 |
agacattattt |
130 |
Q |
| |
|
|||| |||||| |
|
|
| T |
22191270 |
agactttattt |
22191280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 135 - 179
Target Start/End: Original strand, 6983341 - 6983385
Alignment:
| Q |
135 |
atttattttcaaatgcatctctgatattaccaatttaatgtcatc |
179 |
Q |
| |
|
|||||||||||||| |||||| |||||||||| ||||||||||| |
|
|
| T |
6983341 |
atttattttcaaattcatctcctatattaccaacttaatgtcatc |
6983385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University