View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12110_low_19 (Length: 283)
Name: NF12110_low_19
Description: NF12110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12110_low_19 |
 | |
|
| [»] scaffold0082 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0082 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: scaffold0082
Description:
Target: scaffold0082; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 19 - 283
Target Start/End: Complemental strand, 17637 - 17373
Alignment:
| Q |
19 |
ggtgagcctagtgataggagactatctagcttggttcggagagcacttgttgggttaaagattttttgttgctaaatgttatgttacggcctaaatgctg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17637 |
ggtgagcctagtgataggagactatctagcttggttcggagagcacttgttgggttaaagattttttgttgctaaatgttatgttacggcctaaatgctg |
17538 |
T |
|
| Q |
119 |
aactattgaccctacttgttcggatgggtgttcaccccaaagtgttcccggaccgcatgcatacatacgtaagtaacttagtgcaacatggcaaatttaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17537 |
aactattgaccctacttgttcggatgggtgttcaccccaaagtgttcccggaccgcatgcatacatacgtaagtaacttagtgcaacatggcaaatttaa |
17438 |
T |
|
| Q |
219 |
ttgagaggaatcagcaaagaaaagaaaaacgggtcaacatgagtattttttataaattgtcctcg |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17437 |
ttgagaggaatcagcaaagaaaagaaaaacgggtcaacatgtgtattttttataaattgtcctcg |
17373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 19 - 171
Target Start/End: Original strand, 27213761 - 27213915
Alignment:
| Q |
19 |
ggtgagcctagtgataggagactatctagcttggttcggagagcacttgttgggttaaagattttt--tgttgctaaatgttatgttacggcctaaatgc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27213761 |
ggtgagcctagtgataggagactatctagcttggttcggagagcacttgttaggttaaagatttttattgttgctaaatgttatgttacggcctaaatgc |
27213860 |
T |
|
| Q |
117 |
tgaactattgaccctacttgttcggatgggtgttcaccccaaagtgttcccggac |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
27213861 |
tgaactattgaccctacttgttcggatgggtgtttagcccaaagtgttcccggac |
27213915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University