View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12110_low_23 (Length: 240)
Name: NF12110_low_23
Description: NF12110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12110_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 6322804 - 6323030
Alignment:
| Q |
1 |
tataaaatagaataaatatgatcaatctgttgttctagaagtgcatgcaattcttggtaaagagttcctttgttagcacttgttggcagatcgtgatact |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6322804 |
tataaaatagaataaatatgataaatctgttgttctagaagtgcatgctcttcttggtaaagagttcatttgttagcacttgttggcagatcgtgatact |
6322903 |
T |
|
| Q |
101 |
aactacttggnnnnnnnnnnnnnnnnnnatggtttgagatttcactatgttgaactttgttggttgtcactttgtatagtttttacattgaaattatggt |
200 |
Q |
| |
|
||||||| || |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
6322904 |
aactactcggttttatttttccttttttatggtttgagatttcactatgttgaaatttgttggttgtcactttgtatagtttttacattggaactatggt |
6323003 |
T |
|
| Q |
201 |
atttgaaaagcgtgtgtatattggtct |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
6323004 |
atttgaaaagcgtgtgtatattggtct |
6323030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University