View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12110_low_25 (Length: 216)
Name: NF12110_low_25
Description: NF12110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12110_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 58; Significance: 1e-24; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 44515407 - 44515318
Alignment:
| Q |
1 |
aaaaatagaacagacccctgttnnnnnnnntggtcatgagcaacaatagcaagctagaacaggtttaattcaaccaaacaccaagtctag |
90 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44515407 |
aaaaatagaacagacccctgttaaaaaaaatggtcataagcaacaatagcaagctagaacaggtttaattcaactaaacaccaagtctag |
44515318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 148 - 193
Target Start/End: Complemental strand, 44515260 - 44515215
Alignment:
| Q |
148 |
cctatcaaaattatttatagagatagtaatgtggggtgttacatcc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44515260 |
cctatcaaaattatttatagagatagtaatgtggggtgttacatcc |
44515215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 182
Target Start/End: Complemental strand, 44509679 - 44509645
Alignment:
| Q |
148 |
cctatcaaaattatttatagagatagtaatgtggg |
182 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44509679 |
cctatcaaagttatttatagagatagtaatgtggg |
44509645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 148 - 192
Target Start/End: Complemental strand, 26505341 - 26505297
Alignment:
| Q |
148 |
cctatcaaaattatttatagagatagtaatgtggggtgttacatc |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
26505341 |
cctatcaaaattatttatagagatagtaatatgggatgttacatc |
26505297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University