View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12110_low_26 (Length: 209)
Name: NF12110_low_26
Description: NF12110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12110_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 20 - 197
Target Start/End: Original strand, 39367114 - 39367291
Alignment:
| Q |
20 |
caactcaatgtttcttgtcccaccttgcactttctacccctactacaagtactaggttttcatcacaacgccaagtagtaaacgtacgcaccaaggcaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39367114 |
caactcaatgtttcttgtcccaccttgcactttctacccctactacaagtactaggttttcatcacaacgccaagtagtaaacgtacgcagcaaggcaaa |
39367213 |
T |
 |
| Q |
120 |
gcagtttttggtttgtaaggctgagaagcaagcaatacaagaggatgatggcaacaacttcatagtctctcacaggtt |
197 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
39367214 |
gcagtttttggtttgtaaggctaagaagcaagcaatacaagaggatgatggcaacaacatcatagtctctcgcaggtt |
39367291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University