View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12111_low_17 (Length: 356)
Name: NF12111_low_17
Description: NF12111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12111_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 9e-89; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 9e-89
Query Start/End: Original strand, 11 - 188
Target Start/End: Complemental strand, 39300331 - 39300154
Alignment:
| Q |
11 |
cacagacgagagagatattcatgttgaaaaagacagagtcccaaagatgacaactcattttgaacaacttacagtggtagacaaggaaccaccacatggt |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39300331 |
cacaaacgagagagatattcatgttgaaaaagacagagtcccaaagatgactacccattttgaacaacttacagtggtagacaaggaaccaccacatggt |
39300232 |
T |
 |
| Q |
111 |
agcattgaagcattacaaggtggtgaaatgaacaaagatcatgcaggaaaagccattggagatattggtggaagagga |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39300231 |
agcattgaagcattacaaggtggtgaaatgaacaaagatcatgcaggaaaagccattggagatattggtggaagagga |
39300154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 203 - 304
Target Start/End: Complemental strand, 39299905 - 39299804
Alignment:
| Q |
203 |
ccatgaacttggttcaaactttcagtctcttcctgatcgtaacgagaatcaaagttaccttgatcgtgcacatgttcgtgatagtgcaaatgtagcagga |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299905 |
ccatgaacttggttcaaactttcagtctcttcctgatcgtaacgagaatcaaagttaccttgatcgtgcacatgttcgtgatagtgcaaatgtagcagga |
39299806 |
T |
 |
| Q |
303 |
aa |
304 |
Q |
| |
|
|| |
|
|
| T |
39299805 |
aa |
39299804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University