View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12111_low_29 (Length: 205)
Name: NF12111_low_29
Description: NF12111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12111_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 4e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 25 - 122
Target Start/End: Complemental strand, 39922800 - 39922703
Alignment:
| Q |
25 |
tatctatgaacttataatcaacatactctagcaaaaatggtattaacttggacccttgatcatttaatttaatgtttgatcattgaccaatgtgtatg |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39922800 |
tatctatgaacttataatcaacatactctagcataaatggtattaacttggacccttgatcatttaatttaatgtttgatcattgaccaatgtgtatg |
39922703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 146 - 194
Target Start/End: Complemental strand, 39922679 - 39922631
Alignment:
| Q |
146 |
cgaaccgttaaatggaatatcaattttctggagagattagtctctgctc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39922679 |
cgaaccgttaaatggaatatcaattttctggagagattagtttctgctc |
39922631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University