View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12111_low_29 (Length: 205)

Name: NF12111_low_29
Description: NF12111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12111_low_29
NF12111_low_29
[»] chr7 (2 HSPs)
chr7 (25-122)||(39922703-39922800)
chr7 (146-194)||(39922631-39922679)


Alignment Details
Target: chr7 (Bit Score: 94; Significance: 4e-46; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 25 - 122
Target Start/End: Complemental strand, 39922800 - 39922703
Alignment:
25 tatctatgaacttataatcaacatactctagcaaaaatggtattaacttggacccttgatcatttaatttaatgtttgatcattgaccaatgtgtatg 122  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39922800 tatctatgaacttataatcaacatactctagcataaatggtattaacttggacccttgatcatttaatttaatgtttgatcattgaccaatgtgtatg 39922703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 146 - 194
Target Start/End: Complemental strand, 39922679 - 39922631
Alignment:
146 cgaaccgttaaatggaatatcaattttctggagagattagtctctgctc 194  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||    
39922679 cgaaccgttaaatggaatatcaattttctggagagattagtttctgctc 39922631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University