View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12112_low_5 (Length: 255)
Name: NF12112_low_5
Description: NF12112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12112_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 44 - 247
Target Start/End: Complemental strand, 32887487 - 32887284
Alignment:
| Q |
44 |
ttgtgttttcatggtttgatttcttctcattgttttcaaagtcaaatatcgatgttcaaattattttgagtattatatcaaaagagttgtttgtggtata |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32887487 |
ttgtgttttcatggtttgatttcttctcattgttttcaaagtcaaatatcgatgttcaatttattttgagtattatatcaaaagagttgtttgtggtata |
32887388 |
T |
 |
| Q |
144 |
gtataaaaataattgcgtatcagtatcaaatatctacaagattctctcaaaactccttctcgttcggcttaaacaaatcatccataagtgcatctctgct |
243 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||||||||||||| ||| |||||||||||||||| |||||||||||||| || |||| | |
|
|
| T |
32887387 |
gtataaaaataattgggtatcaatatcaaatatctacaagattctctcaaaacttcttgtcgttcggcttaaacagatcatccataagtgtatatctgat |
32887288 |
T |
 |
| Q |
244 |
tctc |
247 |
Q |
| |
|
|||| |
|
|
| T |
32887287 |
tctc |
32887284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University