View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12113_high_12 (Length: 208)
Name: NF12113_high_12
Description: NF12113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12113_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 17 - 190
Target Start/End: Original strand, 52769664 - 52769837
Alignment:
| Q |
17 |
agagtaatccaccaatgctagctacagaagtgagacacaaaatgtaagggttcttaaacacagagactttcctttcagggtgtgtatccaaatacccaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
52769664 |
agagtaatccaccaatgctagctacagaagtgagacacaaaatgtaagggttcttaaacacagagacttttctttcagggtgtatatccaaatacccaga |
52769763 |
T |
|
| Q |
117 |
gcttcctggaattcgaattgatgttgttatcgtcatctcatcgtaacaaagattaatggattggatgattagtt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52769764 |
gcttcctggaattcgaattgatgttgttaccgtcatctcatcgtaacaaagattaatggattggatgattagtt |
52769837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University