View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12113_low_10 (Length: 341)
Name: NF12113_low_10
Description: NF12113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12113_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 11 - 326
Target Start/End: Original strand, 35811029 - 35811344
Alignment:
| Q |
11 |
cagagaagaggcaaggatttctgggctgaatttgagttgtatgctgctgatcttcttgttggtgtggctgttgacattgctttggtgggtctgttggcac |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35811029 |
cagaaaagaggcaaggatttctgggctgaatttgagttgtatgctgctgatcttcttgttggtgtggctgttgacattgctttggtgggtctgttggcac |
35811128 |
T |
|
| Q |
111 |
cttatgcacgaatcggcaagcctgctttgtcaaaaggtttacttggacgcattcaacacgcttgtgctgctcttcctagcaggttagtgtctgcatttat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35811129 |
cttatgcacgaatcggcaagcctgctttgtcaaaaggtttacttggacgcattcaacacgcttgtgctgctcttcctagcaggttagtgtctgcatttat |
35811228 |
T |
|
| Q |
211 |
atgtatcgaataaggatgatgttgttcctttttaatttttattgcaatgtttttacacttcccccttcctttttgataataaagctagaaagacacatga |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35811229 |
atgtatcgaataaggatgatgttgttcctttttaatttttattgcaatgtttttacacttcccccttcctttttgataataaagctagaaagacacatga |
35811328 |
T |
|
| Q |
311 |
tttgatacacactttt |
326 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
35811329 |
tttgatacacactttt |
35811344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University