View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12113_low_11 (Length: 295)
Name: NF12113_low_11
Description: NF12113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12113_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 11 - 278
Target Start/End: Complemental strand, 23893055 - 23892788
Alignment:
| Q |
11 |
cacagagacaatattacaaccgcgtttacgaaggttttcatccgtgggtaacctgttatgcgctaacctccagaaaacaaaggacctagtgggagggaga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
23893055 |
cacagagacaatattacaaccgcgtttacgaaggttttcatccgtgggtaacctgttatgcgctaacctccagaaaacaaaggacctagtgggagggaca |
23892956 |
T |
|
| Q |
111 |
aaagagttccaagctagcttgcactaccgtaaagctggtctagaaacacgcagagcgctgtaagctatctgacaagtcagctctccatcactagaacccc |
210 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23892955 |
aaagagttccaagctagcttgcaccaccgtaaagctggtccagaaacacgcagagcgctgtaagttatttgacaagtcagctctccatcactagaacccc |
23892856 |
T |
|
| Q |
211 |
tccaattcaacttttcagacgtgtcttctgtagggagagtcacagtgagaatctgcctagctagactt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23892855 |
tccaattcaacttttcagacgtgtcttctgtagggagagtcacagtgagaatctgcctagctagactt |
23892788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 11 - 266
Target Start/End: Original strand, 39398097 - 39398354
Alignment:
| Q |
11 |
cacagagacaatattacaaccgcgtttacgaaggttttcatccgtgggtaacctgttat--gcgctaacctccagaaaacaaaggacctagtgggaggga |
108 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39398097 |
cacaaagacaatattacaaccgtgtttacgaaggttttcatccgtgggtaacctgttatatgcgctaacctccagaaaccaaaggacctagtgggaggga |
39398196 |
T |
|
| Q |
109 |
gaaaagagttccaagctagcttgcactaccgtaaagctggtctagaaacacgcagagcgctgtaagctatctgacaagtcagctctccatcactagaacc |
208 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39398197 |
caaaagagttccaagctagcttgcaccaccgtaaagctggtccagaaacacgcagagcattgtaagctatctgacaagtcagctctccatcactagaatc |
39398296 |
T |
|
| Q |
209 |
cctccaattcaacttttcagacgtgtcttctgtagggagagtcacagtgagaatctgc |
266 |
Q |
| |
|
||||||||||||||| ||| | |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39398297 |
cctccaattcaacttatcatatgtgtcttctgtagggaaagtcacagtgagaatctgc |
39398354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University