View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12113_low_12 (Length: 275)
Name: NF12113_low_12
Description: NF12113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12113_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 13 - 256
Target Start/End: Original strand, 43376027 - 43376278
Alignment:
| Q |
13 |
atctgatctggtagggtgagttcgaaggtcaattatcaacgtggttaccttagaacacgtggcgttaagttaaagaaaaggtaaacagtgtcattcccgt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43376027 |
atctgatctggtagggtgagttcgaaggtcaattgtcaacgtggttaccttagaacacgtggcgttaagttaaagaaaaggtaaacagtgtcattcccgt |
43376126 |
T |
|
| Q |
113 |
gtttttgacaactaggnnnnnnnnn--------caaattttattcgtttcgattttgcattacattaacgtagagaattctcaaaaacacatttgagtct |
204 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43376127 |
gtttttgacaactagaaaaaaaaaaaaaaaaaacaaattttattcgtttcgattttgcattacattaacgtagagaattctcaaaaacacatttgagtct |
43376226 |
T |
|
| Q |
205 |
atttcttgttttgtttcccacagagttaggagttcccgatctaccttaattc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43376227 |
atttcttgttttgtttcccacagagttaggagttcccgatctaccttaattc |
43376278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University