View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12113_low_13 (Length: 251)
Name: NF12113_low_13
Description: NF12113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12113_low_13 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 16 - 251
Target Start/End: Complemental strand, 44515638 - 44515394
Alignment:
| Q |
16 |
cttttcagtcggaatgccattatctcttatagtacgaagtacttcctcacaagtaaagccaccaaccacatcctcaatg---------tgtatattacct |
106 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44515638 |
cttttcagtcggaatgccactatctcttatagtacgaagtacttcctcgcaagtaaagccaccaaccacatcctcaatgcactcaatgtgtatattacct |
44515539 |
T |
 |
| Q |
107 |
tcactcgttttacacattccctccaaccgttgacgtgcaaaacggtttactgcgtattgtgtagaaagctcaattggatcttcaggcctaagggcgcaat |
206 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44515538 |
tcactcattttacacattccctccaaccgttgacgtgcaaaacggtttactacgtattgtgtagaaagctcaattggatcttcaggcctaagggcgcaat |
44515439 |
T |
 |
| Q |
207 |
tgatcacgctttcaacacaagaaacaacaccaaaaatagaacaga |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44515438 |
tgatcacgctttcaacacaagaaacaacaccaaaaatagaacaga |
44515394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University