View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12113_low_14 (Length: 242)
Name: NF12113_low_14
Description: NF12113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12113_low_14 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 17 - 242
Target Start/End: Original strand, 44155407 - 44155633
Alignment:
| Q |
17 |
tgggatggccaccggtgagggcaagcaggaaaaatattggtatgaagaatagtatttgcaagtacgtgaaagttgcggttgatggagctccatatctaag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44155407 |
tgggatggccaccggtgagggcaagcaggaaaaatattggtatgaagaatagtatttgcaagtacgtgaaagttgcggttgatggagctccatatctaag |
44155506 |
T |
 |
| Q |
117 |
aaatgtggatcttgaagtttctgaatgttatgacaatcttctcactgcattgaataccatgttttctactaattgcttcactattcgtccgtcttcattc |
216 |
Q |
| |
|
||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
44155507 |
aaaagtggatcttgaagtttatgaatgttatgacaatcttctcactgcattgaataccatgttttctactaattgcttcactattcgtacgtattcattc |
44155606 |
T |
 |
| Q |
217 |
atcttc-aacaatgatatattgtgttt |
242 |
Q |
| |
|
||| || |||||||||||||||||||| |
|
|
| T |
44155607 |
atcatcaaacaatgatatattgtgttt |
44155633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University